Ізденістер, №2 исследования, НӘтижелер 2013 результаты



жүктеу 5.37 Mb.
бет4/26
Дата31.03.2016
өлшемі5.37 Mb.
1   2   3   4   5   6   7   8   9   ...   26
: material
material -> Сабақтың тақырыбы : Допты алып жүрудің түрлері. Сабақтың мақсаты : Допты алып жүруді үйрету, әдісін-тәсілін үйрету
material -> Маңғыстау облысы Қарақия ауданы Жетібай ауылы №3 орта мектептің бастауыш сынып мұғалімі Самамбетова Қарлығаш Ашық тәрбие сағаты 2-сынып Тақырыбы
material -> Сабақ тақырыбы: М.Әуезов
material -> ТӨлеби ауданы №7 жалпы орта білім беретін мектебі коммуналдық мемлекеттік мекемесі
material -> Сабақтың тақырыбы: Жамбыл өмірі мен шығармашылығы. Сабақтың мақсаты
material -> Абай Құнанбаевтың табиғат лирикасындағы қазақ ауылының көрінісі
material -> «Қарағайдың қарсы біткен бұтағы» атты қайсар ақын
material -> Сабақтың тақырыбы : Сыр сүлейі Нұртуған Сабақтың мақсаты: Сыр сүлейі Нұртуғанның шығармаларымен таныстыру
material -> Сабақтың мақсаты: Оқушыларға ұлы А. Құнанбаевтың шығармашылығымен
material -> Сабақтың тақырыбы: Қазақстан халқының XVIII-XIX ғасырлар аралығында рухани мәдениетінің дамуы
Summary. In the process of work carrying out, a new ointment was created on natural mineral schungite basis. The ointment influences positively on wound healing process. Usage of “Vetschungite” ointment on animal septic wounds reduces inflammatory edema, wounds are cleaned from pus faster and wounded cavity is filled with granulation tissue, wounded area
epithelization is accelerated also. A pre-patent №18504 “Vetschungite” ointment for healing septic wounds” was taken out by the following authors A. A. Abdulla, A. M. Nametov, B. K. Ilyasov. Patent application date 03.05. 2006, registered 03.04.2007.

References




  1. G.P. Gryadunova “Study of some surface active substances emulsifying characteristics, stabilizing emulsive water in oil type ointment bases” //France – 1968. - №4. - Ps. 18-23.

  2. W. Fürst, Falk M. Lipoidmodelle der Arzneimittel //”Resorption - Permeation und Penetration”. Die Pharmazie. – 1970. - №4, - Ps. 205-213.

  3. M. X. Gluzman, G. S. Bashura “Evaluation of surface active qualities of some emulgators and cellulose water-soluble ethers”. //Oil and fat industry. – 1965. - №7. - Ps.20-23.

  4. V.V. Vladimirov “Comparative study of paraffin – ozokerite therapy, applied to dermatological patients.” //С.A. "Modern issues of pathogenesis clinic and dermatosis therapy” 1 ММI. - М., 1968. - Ps.155-163.

  5. I. I. Voldenson. “Methods of determination of physical and chemical characteristics of cosmetic creams” //Oil and fat industry. – 1969. - №11. - Ps. 29-31.

  6. A. A. Abdulla, K. A. Orynkhanov, A. S. Tuyakbaeva, A. M. Nametov “ Vetschungite” Ointment influence on healing experimental laboratory animal burns” //Investigations, results. – Almaty, 2008, - №1.– Ps.26-28.

А.М. Наметов, А.А. Абдулла, К.А. Орынханов


ІРІҢДІ ЖАРАНЫ «ВЕТШУНГИТ» МАЙЫМЕН ЕМДЕУ
Жараны емдеудің көптеген әдістері белгілі. Болашағы бар зерттеулердің бірі лазермен сәулелендіру, дәрілік және өсімдік препараттары, торшалық культуралар, реттеуіштер.

Соған орай, бір жағынан жергілікті қабыну процестеріне және иммунды жүйеге әсер ететін экологиялық таза қуаттандырғыштарды және экономикалық, техникалық қолдану жағынан тиімді кешенді ем іздеуге қызушылық туғызады

Емдік және шипалы әсер ететін табиғи заттардың бірі шунгит болып табылады.

Біздің жұмысымыздың мақсаты іріңді жараны емдейтін майды дайындау. Ол мақсатқа жету үшін келесі міндеттер қойылды. Шунгит негізінде майды дайындау технологиясын жетілдіру.



Кілт сөздер: майлар, емдеу, іріңді жара, шунгит.
А.М. Наметов, А.А. Абдулла, К.А. Орынханов
МАЗЬ ДЛЯ ЛЕЧЕНИЯ ГНОЙНЫХ РАН «ВЕТШУНГИТ»
Известно много различных способов лечения ран. Перспективны разработки и исследования по локальному применению лазерного излучения, новых лекарственных и растительных препаратов, клеточных культур, регуляторов.

В этой связи вызывает интерес поиск эффективных, экономически выгодных, технически простых способов комплексного лечения с одновременным воздействием на местный воспалительный процесс и на иммунную систему организма животных экологически чистых стимуляторов.

Одним из природных средств, обладающих оздоровительным и лечебным действием, является шунгит.

Целью нашей работы явилось разработка мази для лечения гнойных ран.

Для достижения указанной цели на решение поставлены следующие задачи:

Разработать технологию изготовления мази на основе действующего начала шунгита.



Ключевые слова: мазь, лечения, гнойные раны, шунгит.

УДК 619:616-07/619.3


С.Ш. Нурабаев
РГП "НИИ проблем биологической безопасности" КН МОН Республики Казахстан
Подбор и синтез специфических праймеров для ПЦР при чуме мелких жвачных животных
Аннотация. В результате проведенных работ по отбору нуклеотидных последовательностей генома или отдельных фрагментов РНК вируса из международных баз данных показало огромное количество последовательностей для вируса чумы МЖЖ, хранящиеся в банках генов и ежедневно пополняющиеся новыми данными.

Конструирование праймеров с соблюдением необходимых параметров проводится с помощью различных компьютерных программ, основными из которых являются Pirmer 3, Oligo 6, Oligo Software и другие.

Сконструированные праймеры затем синтезировали на синтезаторе олигонуклеотидов Expedite 8909, согласно инструкции прилагаемой к прибору.

В результате проведенных опытов нами были подобраны и синтезированы специфические праймеры PCR_PPRV_f3 и PCR_PPRV_r3 для постановки ПЦР при чуме мелких жвачных животных.


Ключевые слова: праймер, синтез, РНК, вирус чумы мелких жвачных животных.
Ведение

Праймер (англ. primer) - это короткий фрагмент нуклеиновой кислоты, который служит стартовой точкой при репликации ДНК. Праймеры необходимы ДНК-полимеразам, так как ДНК-полимеразы могут только наращивать существующую цепь. Полимеразы начинают репликацию с 3'-конца праймера, и создают копию другой цепи [1, 2].

В большинстве случаев естественной репликации ДНК, праймером для синтеза ДНК является короткий фрагмент РНК (создаваемый заново). Такой рибонуклеотидный праймер создается ферментом праймазой, и впоследствии заменяется дезоксирибонуклеотидами полимеразой, выполняющией в норме функции репарации [2].

Многие лабораторные методы в биохимии и молекулярной биологии, которые предполагают использование ДНК-полимеразы, такие, как секвенирование или полимеразная цепная реакция, требуют наличие праймеров. Такие праймеры обычно короткие, химически синтезированные олигонуклеотиды, длиной порядка двадцати оснований. Они гибридизуются с ДНК-мишенью, которая затем копируется полимеразой [3].

Важно отметить, что не совсем удачный выбор праймера может привести к появлению неспецифического продукта амплификации из-за образования "праймерного димера". Этот побочный продукт амплификации представляет собой двунитевой фрагмент, возникающий за счет отжига праймеров с их последующей достройкой Taq-полимеразой [4, 5]. Праймеры должны быть специфичны. Если их специфичность недостаточна, то вероятней всего в пробирке с реакционной смесью будут происходить нежелательные процессы, а именно синтез неспецифической ДНК. При электрофорезе

неспецифическая ДНК выявляется в виде тяжелых или легких дополнительных полос, иногда шмеров, выглядящих сплошным мазком в агарозном геле. Часть праймеров и дНТФ расходуется на синтез неспецифической ДНК, что приводит к значительной потере чувствительности [6, 7].

В данной работе нами показаны подбор и синтез специфических праймеров для отработки условий постановки ПЦР, используемый для диагностики чумы МЖЖ.

Материалы и методы

Оборудование

- генетический анализатор "ABI PRISM 310 Genetic Analyser",

"Applied Biosystems";

- синтезатор олигонуклеотидов Expedite 8909, Applied Biosystems;

- термоциклер GeneAmp PCR System 9600, Applied Biosystems;

- РНК/ДНК калькулятор GenQuant Pro RNA/DNA Calculator, Amersham-Pharmacia-Biotech;

- рН-метр Delta 320 Mettler Toledo;

- универсальная цифровая система документации DigiDoc-Jt, UVP;

- системы грубой и высокой очистки воды Water Pro Ro PS/UF, Labconco;

- - аппарат для электрофореза нуклеиновых кислот G-100, Pharmacia;

- цифровой фотоаппарат для фотографирования гелей, Olympus;

- пакет прикладных программ для анализа последовательностей ДНК - DNASYS MAX 1.0, Sequencher, Vector NTI, BioEdit, GENEDOC, Staden package.

- низкоскоростная рефрижераторная центрифуга "J6-HC Centrifuge", Beckman-Coulter.



Методы исследований

Синтез подобранных праймеров осуществляли на синтезаторе нуклеотидов "Expedite 8909" фирмы "Applied Biosystems" согласно протоколам, прилагающимся к прибору. Полученные олигонуклеотиды элюировали с колонок концентрированным раствором аммиака и выпаривали в вакуумном испарителе CentriVap Concentrator, LABCONCO. Синтезированные праймеры переосаждали этанолом, ресуспендировали в высокоочищенной воде и хранили при минус 20 0С.



Результаты исследований

В настоящее время ПЦР используется для детекции многих вирусных инфекций. Непосредственно для детекции нуклеиновой кислоты вируса ЧМЖ ПЦР была впервые предложена Forsyth M.A. с соавторами [8].

На начальном этапе исследований при разработке метода ПЦР для идентификации возбудителя заболевания первостепенным этапом является поиск нуклеотидных последовательностей в международных базах данных по последовательностям нуклеотидов интересующих генома вируса. Поиск проводился в трех широко известных базах данных: Ген банк (GenBank, USA), Европейская лаборатория Молекулярной биологии (EMBL Nucleotide Sequence Database, Europe) и Японская база данных ДНК (DNA Database Bank of Japan), доступная на сайте National Centre for Biotechnology Information (NCBI).

В результате проведенных работ по отбору нуклеотидных последовательностей генома или отдельных фрагментов РНК вируса из международных баз данных показало огромное количество последовательностей для вируса чумы МЖЖ, хранящиеся в банках генов и ежедневно пополняющиеся новыми данными.

В связи с этим на начальном этапе работ перед нами стояла задача анализа литературных данных по применению метода ПЦР для диагностики чумы МЖЖ.

Особое внимание заслуживают работы, вовлеченные в разработку ПЦР для идентификации вируса чумы МЖЖ. Их близкое родство и высокая гомологичность по нуклеотидным последовательностям затрудняет разработку метода, позволяющего не только идентифицировать возбудителя, но и также дифференцировать данные заболевания. Литературные данные при разработке метода ПЦР для диагностики вируса чумы МЖЖ показывают, что основными объектами при конструировании специфических праймеров являются гены нуклеопротеина и белка слияния. NP-ген, являясь высококонсервативным участком генома для всех морбилливирусов, успешно применяется для диагностики представителей этого рода. Однако ген белка слияния (F-ген) является умеренно консервативным участком генома и может быть использован для разработки праймеров для идентификации вируса чумы МЖЖ и их дифференциации.

В связи с этим в наших работах при конструировании олигонуклеотидных затравок были использованы последовательности генов нуклеопротеина и белка слияния. В результате анализа базы данных Генбанка были сгенерированы более 40 нуклеотидных последовательностей для вируса чумы МЖЖ.

Сравнительный анализ фрагментов генов нуклеопротеина и белка слияния позволил выявить гомологичные участки среди различных штаммов вируса с целью создания специфических праймеров на данные участки (рисунки 1 и 2).




Рисунок 1 - Сравнительный анализ нуклеотидной последовательности фрагментов NP-гена вируса чумы МЖЖ




Рисунок 2 - Сравнительный анализ нуклеотидной последовательности фрагментов F-гена вируса чумы МЖЖ

Эффективность метода ПЦР и его специфичность зависит от многих параметров, включающих буферный состав реакционной смеси, температурно-временной режим и специфичность подобранных праймеров. Однако, наиболее критическим этапом при разработке метода ПЦР, сказывающейся в особенности на его специфичность, является правильный подбор праймеров, его локализация на исследуемой ДНК или РНК.

Конструирование праймеров с соблюдением необходимых параметров проводится с помощью различных компьютерных программ, основными из которых являются Pirmer 3, Oligo 6, Oligo Software и другие. В результате проведенных работ было сгенерировано различное количество пар праймеров на проанализированные участки вируса чумы МЖЖ.



При разработке метода ПЦР для идентификации вируса чумы МЖЖ на начальном этапе исследований был проведен анализ всех имеющихся нуклеотидных последовательностей генома ЧМЖЖ в международном банке генов. Определены консервативные участки, присущие только для представителей данного рода и на данные участки были сконструированы специфические праймеры, позволяющие нарабатывать ПЦР-продукты. В данном случае также проводили предварительный отбор пула праймеров по основным критериям, предъявляемым для ПЦР праймеров. В первую очередь длина олигонуклеотида не должна была превышать 22 нуклеотида, имела допустимое процентное соотношение GC-оснований – 40-70%, температуру плавления и прогнозируемый размер ПЦР продукта, находящийся в пределах 150-400 п.н. Предварительный набор праймеров представлен в таблице 1.
Таблица 1 - Комбинации различных пар праймеров на геном вируса чумы МЖЖ



Прямой праймер

Обратный праймер

1

ATTGGAGAATTCAGGCTTGACA

TGGAACTCTCTAGCTCAACCCCAA

2

GGACAAGAAATGGTACGGAGGTCA

CCAGGATGCTGGCCATAGTCTGCA

3

GGACATCAAGAGAACTCCAGGGAA

ATTAGAGCTGACTTTCCCGGCTGA

4

CACAACCCCTGATACTGCAGCTGA

TGTTCTGGATTGAGTTCTCCAA

5

CTCCTTACATGGTGATTTTGGAGA

CTGCTAGCCCAGGTTTCTTTCCTA

6

CACCTGGCCAACTGATTCAAAGGA

GCTATCCTGTTACGTACTGTGTCA

7

ACATAGTGGAGGCAGGATTGGCTA

GTGTATGCTGCGATTTCAGAGACA

8

GAGGATTGCTGAAATGATCTGTGA

CTCCTCGGTGATGCCAAGCTCAGA

9

TCCAGAGGGGACAGTCTGCA

TGGTGCCTACATCCAGTTTCTCCA

10

ACTCAGCTATGCATTAGGCGGAGA

CCTGAAGCAATGGGCTCATTGGA

11

AGATCCTGTCTATATTCGGGCCTA

GAAGACGCATGACGTCTCATCGAA

12

GCCTGTAGAGGATGCCCTGTCA

AATACCTAAGGAGCTTGAGACTGA

13

CAAAATCGTGCGCCAGAACCCTA

AACAGTCTTCAGTATCTGGTCTGA

14

CACAGTGTTAAAGCCTGTAGAGGA

GCTTGAGACTGAGTTTGTGACCTA

15

CCAATGAGCCCATTGCTTCAGGA

GCATTCTCCAGTCTTGTGACTGCA

16

CAAATTGTGCGTCAGTTTTGTGCA

GACAAGCCCTAGGGATACCCCAA

Из всего пула конструированных праймеров на первом этапе для дальнейших исследований отобраны пять пар праймеров для разработки ПЦР. Параметры праймеров представлены в таблице 2.


Таблица 2 - Краткие характеристики праймеров для постановки ПЦР при идентификации вируса ЧМЖЖ





Последовательность (5'-3')

поз. на геноме

Tm, 0С

Ta,0С

GC,%

ПЦР продукт

1

GGA CAC CCA ACC ACC GAA ACA (PCR_PPRV_f1)

4974

75.8

61.4

57.1

200

TTC CCT GCC GTT TGG TC (PCR_PPRV_r1)

5157

69.2

58.8

2

ATC CAG AGT CGG CTG AAT ACC(PCR_PPRV_f2)

7533

68,9

53,3

52,4

343

GCC CAA GAG TCA ATG ATT GC(PCR_PPRV_r3)

7856

69,1

50,0

3

TGC CGT CTA CCG ATG TT

8425

64,5

54,6

52,9

230

AAG ATC CAT GCC AGA TAG GTG

8634

67,4

47,6

4

CGT TGC CAT GTT CCC ATA GAA

8802

71,0

54,3

47,6

325

CGG TCA GCC CTC TCG TAT

9109

67,3

61,1

5

CAA AGA AAG GGC AGT GTT ATC (PCR_PPRV_f3)

12643

64,9

55,3

42,9

274

ACA CGA AGA GCC GAA GTC (PCR_PPRV_r3)

12899

64,9

55,6

Сконструированные праймеры затем синтезировали на синтезаторе олигонуклеотидов Expedite 8909, согласно инструкции прилагаемой к прибору. Очистку праймеров проводили методом спиртового переосаждения, конечную концентрацию праймера доводили до 20 пг.



Риунок 3 - Локализация специфические праймеров PCR PPRV f3 и PCR PPRV r3 на геноме вируса чумы МЖЖ
Проведенные эксперименты по выбору пары праймеров показали, что оптимальными оказались праймеры PCR_PPRV_f3 и PCR_PPRV_r3, позволяющие нарабатывать ПЦР продукт размером 274 п.н. гена полимеразы.

Вывод

В результате проведенных опытов нами были подобраны и синтезированы специфические праймеры PCR_PPRV_f3 и PCR_PPRV_r3 для постановки ПЦР при чуме мелких жвачных животных.


Литература


  1. Кнорре Д. Г., Мызина С. Д. Биологическая химия - 3. - амплификаци Москва: Высшая школа, 2000. - 479 с. - 7000 экз. - ISBN 5060037207.

  2. Глик Б., Пастернак Дж. Молекулярная биотехнология. Принципы и применение - Москва: Мир, 2002. — 589 с. - ISBN 5030033289.

  3. Альбертс Б., Брей Д., Льюис Дж., Рэфф М., Робертс К., Уотсон Дж. Молекулярная биология клетки: в трех томах - 2. - Москва: Мир, 1994. - Т. 1. - 517 с. - 10000 экз. - ISBN 5030019855.

  4. Dieffenbach C. and Dveksler G. PCR Primer: A Laboratory Manual // Cold Spring Harbor Laboratory Prtss, 2003-700p.

  5. Barlett J. and Stirling D. PCR Protocols // Methods in molecular biology, 2003.-V.226, 556p.

  6. Горбунова В.Н. Молекулярные основы медицинской генетики.// СПб.: Интермедика,1999.-210с.

  7. Охапкина С.С., Акишев А.Г., Дегтярев С.Х. Полимеразно-цепная реакция (ПЦР) и ее применение. http://www.sciencerussian.sibenzyme.com

  8. Forsyth M.A. & Barrett T. (1995). Evaluation of polymerase chain reaction for the detection and characterisation of rinderpest and peste des petits ruminants viruses for epidemiological studies. // Virus Res. -Vol. 39. -№. 2-3. -P. 151-163.

С.Ш. Нурабаев


ҰСАҚ КҮЙІС ҚАЙЫРАТЫН МАЛДАРДЫҢ ОБАСЫН ПТР ӘДІСІМЕН АНЫҚТАУ ҮШІН ТӘНДІ ПРАЙМЕРЛЕРДІ СИНТЕЗДЕУ
Ұсақ күйіс қайыратын малдардың обасын ПТР әдісімен анықтау үшін праймерлер іріктелініп алынды және синтезделінді.

Кілт сөздер: праймер, синтез, РНҚ, ұсақ күйіс қайыратын малдар обасы.
S.Sh. Nurabayev
RECRUITING AND SYNTHESIS OF SPECIFIC PRIMERS FOR PCR WITH THE PLAGUE OF SMALL RUMINANTS
Chosen and synthesizing primers for statement PCR at a peste des petits ruminants

Keywords: primer, synthesis, RNA, рeste des petits ruminants virus.

УДК 619:578.831.2:57.083.138


С.Ш. Нурабаев
РГП Научно-исследовательский институт проблем биологической безопасности, ПГТ Гвардейский Жамбыльской области, Казахстан
ПОДБОР СТАБИЛИЗИРУЮЩИХ СРЕД ДЛЯ ЛИОФИЛЬНОЙ СУШКИ АНТИГЕНА ПРИ ЧУМЕ МЕЛКИХ ЖВАЧНЫХ ЖИВОТНЫХ
Аннотация. При исследовании различных стабилизирующих сред, добавляемых в диагностические препараты при их лиофилизации, испытаны различные их концентрации, а также компонентный состав.

В ходе проведенных опытов установлено, что кроме стабилизатора Сахароза/ Желатин/Агар, 7,5/1,5/0,2% остальные испытанные защитные среда в два, иногда в восемь раз снижают активность специфических антигенов чумы МЖЖ после процесса лиофильной сушки.

В ходе опытов подобрана оптимальная защитная добавка для антигенов при чуме мелких жвачных животных, которой является Сахароза/Желатин/Агар, в концентрации 7,5/1,5/0,2% соответственно.

Ключевые слова: стабилизатор, желатин, сахароза, агар, пептон

Введение


Одним из главных моментов при приготовлении диагностических препаратов при чуме мелких жвачных животных является подбор стабилизирующих сред в процессе лиофильной сушки материалов. Для лиофильной сушки диагностических препаратов в научных и производственных учреждениях в качестве стабилизирующих сред широко используются желатин, агар, бычий сывороточный альбумин, пептон, сахароза, лактоза, обезжиренное молоко и другие материалы [1-4].

Целью нашей работы являлось- подбор стабилизирующих сред для диагностических препаратов, которые обеспечивают длительное хранение препаратов с минимальной потерей их активности в процессе хранения.

Материалы и методы

В работе использовали следующие препараты:

- антигены специфические при чуме мелких жвачных животных серии №18, 13 и 21;

- антиген нормальный (контрольный) серия №4;

- диагностические наборы для РДП и ИФА при чуме мелкого рогатого скота;

- защитные среды: желатин, агар, бычий сывороточный альбумин , пептон, сахароза, лактоза, обезжиренная молоко.

Процесс лиофилизации диагностических препаратов при чуме мелких жвачных животных проводили по следующей схеме:

1. Глубокая заморозка в течение 12 часов при температуре 560С;

2. Вакуум 0,8-1,0 бар;

3. Режим лиофилизации 15% / 150С;

4. Досушивание препарата после лиофилизации проводили при температуре + 240С в течение 8-10 часов;

5. Продолжительность лиофилизации 36 часов.

До и после лиофилизации и процессе хранения диагностических препаратов проверяли их активность в лабораторных тест-системах (ИФА, РДП).

Постановка РДП

В агаре по трафарету с помощью металлической трубки делали лунки диаметром 0,5 см3 на расстоянии 0,3-0,4 см друг от друга. Лунки располагали таким образом, чтобы одна из них находилась в центре и 6 лунок вокруг нее.

Для обнаружения антигена в испытуемых пробах РДП ставили одновременно с двумя стандартными (специфическим и нормальным) компонентами реакции. При исследовании антигенов в центральные лунки вносили стандартные специфическую и нормальную сыворотки в рабочем разведении, а в периферические - испытуемые антигены в цельном виде и в двукратных разведениях. После постановки реакции чашки Петри закрывали крышками, ставили под стеклянный колпак и выдерживали 24-72 ч при комнатной температуре.

Результаты реакции начинали учитывать с контролей, в которых обязательно должны быть линии преципитации между стандартным специфическим антигеном и стандартной специфической сывороткой при отсутствии их между нормальной сывороткой и специфическим антигеном и специфической сывороткой и нормальным антигеном.

Реакцию считали положительной, если между лунками с испытуемыми антигенами и специфической сывороткой через указанное выше время имеются линии преципитации по характеру идентичные линиям в контроле. При отсутствии линий преципитации между указанными компонентами реакцию считали отрицательной.

Иммуноферментный анализ ставили по следующей схеме:

- сенсибилизация лунок полистироловых планшет специфическими иммуноглобулином или антигеном чумы МЖЖ, взятыми в рабочей концентрации в течение 18ч при 4ºС;



  • время контакта испытуемых и контрольных антигенов с иммуноглобулинами или сывороток с антигеном, закрепленными на твердой фазе в течение 18ч при 4ºС;

  • взаимодействие вирусспецифического или антивидового конъюгатов с антигенами или сыворотками в течение 1ч при 37ºС, а затем с субстратом в течение 15-30 минут при комнатной температуре.

Результаты и обсуждение

При добавления стабилизирующих сред в диагностические препараты испытаны различные концентрации, также в сочетании с другими стабилизирующими средами.

Компонентное и процентное содержание дополнительных добавок представлены в таблице 1.
Таблица 1 – Содержание и состав стабилизирующей среды


№№

п/п


Наименование компонентов

Содержание в ТЖ, %

1

Пептон/Сахароха

2,5:2,5

2

Пептон/Сахароза

3/3

3

Сахароза/Желатин/Агар

7,5/1,5/0,2

4

Обезжиренная молоко

50

5

Пептон/лактоза

3/2,5

6

БСА

0,5

7

БСА

1

8

Пептон/БСА

2/0,5

До и после процесса лиофилизации определяли активность диагностических препаратов в РДП и ИФА, которые представлены в таблице 2.



Таблица 2 – Активность антигенов в РДП и ИФА до и после сушки с защитной средой

Наименование стабилизирующих сред и содержание, в %

Наименование диагностических препаратов

До сушки

После сушки

в РДП

в ИФА

в РДП

в ИФА

Пептон/Сахароха, 2,5:2,5

Антиген специфический серия №18

1:8

1:1280

1:2

1:320

Пептон/Сахароза, 3/3

1:8

1:1280

1:4

1:320

Сахароза/Желатин/Агар, 7,5/1,5/0,2

1:8

1:1280

1:8

1:1280

Обезжиренная молоко, 50

1:8

1:1280

ц

1:64

Пептон/лактоза, 3/2,5

1:8

1:1280

1:4

1:640

БСА, 0,5

1:8

1:1280

1:8

1:320

БСА, 1

1:8

1:1280

1:4

1:320

Пептон/БСА, 2/0,5

1:8

1:1280

1:2

1:160

Пептон/Сахароза, 2,5:2,5

Антиген специфический, серия №13

1:16

1:2560

1:16

1:2560

Пептон/Сахароза, 3/3

1:16

1:2560

1:4

1:640

Сахароза/Желатин/Агар, 7,5/1,5/0,2

1:16

1:2560

1:8

1:1280

Обезжиренное молоко, 50

1:16

1:2560

1:2

1:640

Пептон/лактоза, 3/2,5

1:16

1:2560

1:4

1:1280

БСА, 0,5

1:16

1:2560

1:8

1:640

БСА, 1

1:16

1:2560

1:4

1:320

Пептон/БСА, 2/0,5

1:16

1:2560

1:4

1:640

Пептон/Сахароза, 2,5:2,5

Антиген нормальный, серия №4

-

-

-

-

Пептон/Сахароза, 3/3

-

-

-

-

Сахароза/Желатин/Агар, 7,5/1,5/0,2

-

-

-

-

Обезжиренное молоко, 50

-

-

-

-

Пептон/лактоза, 3/2,5

-

-

-

-

БСА, 0,5

-

-

-

-

БСА, 1

-

-

-

-

Пептон/БСА, 2/0,5

-

-

-

-

В ходе проведенных опытов установлено, что кроме стабилизатора Сахароза/ Желатин/Агар, 7,5/1,5/0,2% все защитные среда в два, иногда в восемь раз снижают активность специфических антигенов чумы МЖЖ после процесса лиофильной сушки. Стабилизатор в состав которого входят Сахароза/Желатин/Агар, 7,5/1,5/0,2% нас вполне устраивал, так как при применениия данного стабилизатора активность антигенов после сушки снижалась на один порядок.

На следующем этапе исследований определяли сохраняемость активности данных антигенов со стабилизатором Сахароза/Желатин/Агар, 7,5/1,5/0,2% при различных температурно-временных режимах хранения (40С; 22-250С; минус 200С).

После хранения в течение 3-х мес. при различных температурных режимах в экспериментальных образцах препарата, определяли активность в РДП и ИФА. Результаты представлены в таблице 3.


Таблица 3 – Активность антигенов в РДП и ИФА после хранения в течение 3-х месяцев

Наименование стабилизирующих сред и содержание, в %

Наименование диагностичес-ких препаратов

Температура хранения антигенов, 0С

Активность антигенов до хранения

Через 3 месяца после хранения

в РДП

в ИФА

в РДП

в ИФА

Сахароза/Желатин/Агар, в концентрации 7,5/1,5/0,2% соответственно


Антиген специфический серия №18

4

1:8

1:1280


1:8

1:1280

22-25

1:2

1:160

минус 20

1:8

1:1280

Антиген специфический, серия №13

4

1:8

1:1280


1:8

1:1280

22-25

1:4

1:640

минус 20

1:8

1:1280

Антиген специфический, серия №21

4

1:8

1:640


1:4

1:320

22-25

1:4

1:160

минус 20

1:8

1:640

Антиген нормальный, серия №4

4

-

-


-

-

22-25

-

-

минус 20

-

-

Проведенные исследования показали, что антигены оказались более устойчивыми при хранении в течении 3 мес. при минусовых температурах и в условиях бытового холодильника, так как потери активности антигенов при этих температурах не наблюдали.

Выводы

В результате нами были проведены опыты по подбору стабилизирующих сред при лиофильной сушки диагностических препаратов против чумы мелких жвачных животных. В ходе опытов подобрана оптимальная защитная добавка для антигенов при чуме мелких жвачных животных, которой является Сахароза/Желатин/Агар, в концентрации 7,5/1,5/0,2% соответственно.



Литература

  1. Кульбаева К.Р., Троицкий Е.Н., Копа Л.А. и др. Получение пылевидных образцов вакцины против оспы овец из штамма “НИСХИ” способом лиофильного высушивания.// Тезисы научной конференции “Актуальные проблемы вирусологии” , пгт. Гвардейский, 1994.

  2. Абдрахманов С.К., Уфимцев К.П., Битаев К.Б. Изучение стабилизирующего эффекта различных добавок для вируса болезни Ауески. //Сборник научных трудов АЗВИ “Резервы биотехнологии, ветеринарной медицины и зоотехнии в повышении эффективности животноводства”, Алматы, 1995

  3. Битов Н.Т., Кыдырбаев Ж.К., Далбаев Н.К. Выбор защитной среды для изготовления пылевидной вирусвакцины против болезни Ньюкасла. //Биотехнология. Теория и практика 2000, № 1-2

  4. Троицкий Е.Н., Копа Л.А., Рыскельдинова Ш.Ж. Таблетирование вирусных препаратов и изучение их сохраняемости. //Матер. межд. конф. ”Современный эпидемический потенциал природных очагов чумы - Талдыкорган. 2001.

С.Ш. Нұрабаев


ҰСАҚ КҮЙІС ҚАЙЫРАТЫН МАЛДАРДЫҢ ОБАСЫ АНТИГЕНІН ЛИОФИЛЬДІ КЕПТІРУ ҮШІН СТАБИЛИЗАТОРДЫ АНЫҚТАУ
Ұсақ күйіс қайыратын малдардың обасы антигенін лиофильді кептіру үшін ең қолайлы стабилизді жарамды орта анықталынды.

Кілт сөздер: стаблизатор, желатин, сахароза, агар, пептон.
S.Sh. Nurabayev
SELECTION OF STABILIZING MEDIA DURING LYOPHILIC DRYING OF DIAGNOSTIC PRODUCTS FOR THE PLAGUE OF SMALL RUMINANTS
Chosen the optimal stabilizing environment suitable for lipophilic drying diagnostic products in a peste des petits ruminants

Keywords: stabilizer, gelatin, sucrose, agar, peptone.

УДК:619:616.995.121:591.8



1   2   3   4   5   6   7   8   9   ...   26


©netref.ru 2017
әкімшілігінің қараңыз

    Басты бет