Қазақстан республикасы білім және ғылым министірлігі



бет2/8
Дата28.04.2016
өлшемі1.4 Mb.
түріСборник
1   2   3   4   5   6   7   8

А В

Рис.1 `Морфология клеток линия MDA-MB-435 (А) контроль Luciferase (B) нокдаун mTOR


Рис.2 `Вестерн-блот иммунопреципитатов полученных из клетоной линии HEK 293T с применением mTOR (рис.А), тубулин (В), pAkt437 (C) антител

Таким образом, mTOR сигналинг регулирует клеточный рост и размер клеток, активируя множество анаболических процессов, включая биосинтез белков, липидов и органелл, а также ограничивая катаболические процессы, такие как аутофагия. В связи с чем, изучение данного сигнального пути является приоритетным направлением в исследовании процессов канцерогенеза с целью дальнейшей разработки методов лечения и профилактики онкологических заболеваний.


ӘОЖ 575.113:616.223-002


Бронх демікпесімен ауыратын балалардағы глутатион S- трансфераза (GSTM1, GSTT1, GSTP1) генінің полиморфизмі

Ералина Ғ.Ж

Л.Н. Гумилев атындағы Еуразия ұлттық университетінің студенті, Астана

Ғылыми жетекші: Ұқбаева Т.Д

Көптеген елдерде эпидемиологиялық зерттеулер жүргізудің арқасында қоршаған ортаның ластануымен қатар тыныс алу жолдарының, терінің, ас қорыту жүйелерінің, ісік ауруларының деңгейі жоғарылап келе жатқаны анықталды. Сонымен қатар белсенді мультифактериальды аурулардың этиопатогенезі зерттелуде. Қазіргі кезде ксенобиотиктерді зарарсыздандыруға жауапты 300 астам гендер белгілі. Ағзаға түскен токсинді заттарды (ксенобиотиктер) детоксикацияға ұшырататын детоксикация гендері “қоршаған орта гендері” "environmental genes" немесе " генов предрасположенности " "predisponding genes" деп аталады.

Ксенобиотиктердің ферменттік жүйесінің биотрансформациясы ағза мен қоршаған орта арасындағы байланысты тудыра отырып, біріншілік(цитохром P450- тәуелді реакция), екіншілік (қышқылданған өнімдердің коньюгация реакциясы), үшіншілік фазаларды(детоксикация өнімдерін ағзадан шығару) қосады. II фазадағы ферменттердің функциясының бұзылуымен ағзада ксенобиотиктерге қарағанда өте зиянды токсинді метаболиттердің жиналуы патологиялық аурулардың дамуына әкелуде. Детоксикацияның II фазасында ағзаның антиоксидантты қорғаныш звеносы, жасушаның антиперекисті және антирадикальды қорғанышы сонымен қатар қабыну медиаторларының метаболизімінде глутатион-S-трансфераза (GST) маңызды роль атқарады.

GST гендерінің турлері: GSTM1, GSTT1, GSTP1 ксенобиотиктер детоксикациясының екіншілік фазасына қатысатын және ағзаға түскен ксенобиотиктерді глютатионмен байланыстырып нейтрализацияға ұшырататын ферменттерді коделейді [1,2]. Қызметтілік белсенділігі өзгеріске ұшыраған ферменттер осы гендердің делекцияға ұшыраған аллелдерін коделейді және артынша ағзада токсинді заттар жиналады [3, 4]. GSTM1, GSTT1 және GSTP1 гендерінің нөлдік аллельдері тыныс алу жолдарының ісігі, зәр шығару мүшелерінің ісігі, сүт безінің ісігі, эндометриоз жән алғаш түсік тастау кезіндегі тәуекел факторы ретінде қаралады[5, 6,7, 8, 9]. Соңғы жылдары бронх демікпесі гендік деңгейде зерттелуде[10, 11]. Бронх демікпесі ауруының дамуы кезінде GSTM1(0) және GSTT1(0) гендерінің полиморфизмі анықталды. Батыс Европа және ресейде жүргізілген зерттеулер нәтижелері бойынша бронх демікпесінің пайда болуы GST геніне байланысты екені анықталды[12, 13].

Қазақ популяциясы этникалық жағынан бірыңғай болғандықтан GSТ генінің полиморфизімін анықтау мүмкіндігіне йе. Бронх демікпесі мен детоксикация гендерінің полиморфты нұсқаларының ассоциациясы аурудың дамуы кезінде патогенезін және молекулярлы - генетикалық заңдылықтарын түсінуге көмектеседі. GSТ гендерінің туыстығын зерттеуде бронх демікпесі ауруының пайда болуын ертерек болжап және сәйкес емдеу шараларын қолдана аламыз.

Бронх демікпесі (БД)- созылмалы рецидивті ауру, патогенезі арнайы және арнайы емес тітіркенулерге бронхтардың гиперреактивтілдігінен бронхоспазм дамып, эозинофильді гиперсекрециясымен шырышты қабығының ісінуінен болатын қайтымды ұстамалы тұншығу. Бронх (емдеу жолымен және жедел )обструкциясы қайтымды [14].



Бронх демікпесі мультифакториальды кең таралған ауру болып саналады. Зерттеу жұмыстары нәтижелеріне сәйкес соңғы жылдары Қазақстанда [15] сонымен қатар, дүние жүзінде бронх демікпесімен ауыратын науқастардың саны артуда .








2004

2005

2006

2007

2008

2009

001 Ақмола облысы

41

53.7

67.8

150.7

54.5

63

002 Ақтөбе облысы

53.6

38.1

45.9

42.6

40.5

40.5

003 Алматы облысы

32.9

33.4

41.3

34.7

43.9

51.5

004 Атырау облысы

32.8

27.4

40.7

26.6

31.3

36.8

005 Шығыс Қазақстан облысы

31.1

32

39.8

37.8

23.6

28.2

006 Жамбыл облысы

26.4

26.6

46.5

24.1

30.8

32.9

007 Батыс Қазақстан облысы

24.1

28.5

20.8

19.9

22.2

17.5

008 Қарағанды облысы

29

38

37.3

26

30.2

28.6

009 Қызылорда облысы

24.4

20.2

38.1

50.1

36.7

34.3

010 Қостанай облысы

38.8

47.8

62.4

20.4

31.6

27.9

011 Маңғыстау облысы

48.6

37.5

53.9

39.9

55

60.8

012 Павлодар облысы

33.3

50.4

30.5

50.2

36.9

32.3

013 Солтүстік Қазақстан облысы

46.7

44.1

4.1

46.1

40.5

28.6

014 Оңтүстік Қазақстан облысы

40

43.8

53

114.8

43.6

52.6

015 Алматы қ.

47.7

41.3

25.8

23.4

30.8

37.6

016 Астана қ.

92.7

68

84.5

66.3

49.4

57.1

017 ҚАЗАҚСТАН

38.2

39.2

43.1

52

37

40.1

Бронхы демікпесі тыныс алу жолдарының созылмалы ауруларына жатады. Бронх ұлпаларының қабыну тудырушы медиаторлармен байланысы өткір броноконстрикцияға, бронхы жақтауларының отектарына және бронхы бұтақтарының қайта құрылуына әкеледі [16].

Көп жылдар бойына тыныс алудың жетіспеушілігі бронх бұлшықеттерінің бұзылуының нәтижесі деп саналды, бірақ соңғы 25 жылда бронх демікпесінің белгілері тыныс алу жолдарының қабыну процесімен байланысты екені анықталды. Қабыну процесі әртүрлі жасушалардың түрлерінің қатысуымен өтеді, оларға мес жасушалары, эозонофильдер және Т – лимфоциттер жатады. Гиперреактивтілік және бронхылардың обструкциялары қабыну салдары болып табылады.

Қолданылған әдебиеттер:





  1. Sandford A.J., Pare P.D. The genetics of asthma. The important questions // Am. J. Respir. Crit. Care Med – 2000. – V.161. – P. 202-206.

  2. Timens W., Coers W., van Straaten J.F.M., Postma D.M. Extracellular matrix and inflammation: a role for fibroblast-mediated defective tissue repair in the pathogenesis of emphysema? // Eur. Respir. Rev. – 1997. – V.43. – P. 119-123.

  3. Казначеева Л.Ф., Вавилин В.А.. Полиморфизм ферментов биотрансформации ксенобиотиков у детей с атопическим дерматитом // Аллергология. – 2002. – № 4. – С. 38-42

  4. Eaton D.L. Biotransformation enzyme polymorphism and presticide susceptibility // Neurotoxicol. – 2000. – V.21. – № 2. – P.101-111.

  5. Hirvonen A. Husgafvel-Pursiainen K. Karjalainen A., Anttila S., Vainio H. Point-mumational MspI and Ile-val polymorphisms closely linced in the CYP1A1 gene: lack of association with susceptibility to ling cancer in a Finnish study population // Cancer Epidemiol. Biomarers Prev. -1992.-V.1.-P.485-489.

  6. Smith J.A., Helliwell P.S., Isdale Asthma et al. Pineal .Res. 1991.-P.14-17.

  7. Pemble S., Schroeder K., Spenser S. et al. Human glutathione S-transferase theta (GSTT1) cDNA cloning and the characterization of a genetic polymorphism // Biochem. J.- 1994. -V. 300. – P. 271-276.

  8. Гериева М.М., Святова Г.С. Клинико-диагностическая значимость полиморфизма генов глутатион-S-трансферазы при генитальном эндометриозе в казахской популяции // Медицинская генетика. – 2005. – №4. – С.172-174.

  9. LeSouef P. Genetics of asthma. What do we need to know? // Pediatr. Pulmonol.
    – 1997.- suppl 15. – P. 3-8

  10. Саймон Г. Бронхиальная астма. – С-Петербург, 2003. – С. 47-104.

  11. Сиделева О.Г. Полиморфные аллели генов, ассоциированные с патогенезом атопической формы бронхиальной астмы у жителей Северо-запада России // Дис. … к.м.н. – Санкт-Петербург, 2002. – C.22-102.

  12. Богард А.Е. Роль генетических факторов в развитии бронхиальной астмы у детей. //Пульмонология. – 2002. – №1, С. 47-56.

  13. Эткина И.А. Клинико-генетические ассоциации у детей, больных бронхиальной астмой: автореф. … канд. мед. наук:.Уфа, 2001. – С.12-14.

  14. Бикенова Д.С., Биорезонансная терапия в комплексном лечении детей с бронхиальной астмой: дисс. … канд. мед. наук: Алматы, 2006. – 24с.

  15. Украинцева С.В., Сергеев А.С.. Популяционный риск возникновения бронхиальной астмы в г. Москва// Генетика.- 1995.- Т31- №2 - С. 264-267

  16. Ормантаев К.С., Байжанова М.М. Заболеваемость и смертность при бронхолегочной патологии в детском возрасте Республики Казахстан// Педиатрия. – 2002.- №3.- С.21-26.

ӘОЖ 615.373:616.233-002



Иммуноглобулин Е және ИЛ-2- нің балалар бронх демікпесі ауруындағы салыстырмалы көрсеткіштері

Ералина Ғ.Ж

Л.Н. Гумилев атындағы Еуразия ұлттық университетінің студенті, Астана

Ғылыми жетекші: Ұқбаева Т.Д
Балалар арасындағы тыныс алу мүшелерінің патологиясы ғылыми және медициналық тәжірибеде аса маңызды мәселе болып табылады [1,2,3].

Соңғы жылдары тыныс жолдарының обструкциясына байланысты балалар арасында бронх өкпелік аурулар соның ішінде бронх демікпесі жиі кездеседі.

Тыныс алу жолдарының обструкциялары бронхтағы кішкене калибраларда қабынуды туғызады. Көп жағдайда (90-95%) қабынулар екі патологиялық жағдаймен сипатталады: инфекция және аллергиямен [4,5].

Бронх демікпесінің аллергиялық және созылмалы қабынуының даму механизімінде заманауи иммунология маңызды роль атқарады. Бұл зерттеудің мақсаты патогенді звеноны табу сонымен қатар аллергиялық және инфекционды- қабыну процесін іске қосу. Қазіргі заманға сай бронх өкпе жүйесінде Т- лимфоцит- хелперлардың әртүрлі субпопуляциялар арасындағы активтілік дисбалансы Т- хелперлердің біріншілік және Т- хелперлердің екіншілік тобы деп анықталады (Tx-1, Tx-2). Алғаш Tx-1 жасушалары жасушалық реакцияда, ал екінші Tx-2 жасушалары гуморальды иммунитет және аллергияда іске қосылады [6].

Адамдарда кездесетін созылмалы қабыну аурулары Tx-1 және Tx-2 тәуелді деп бөлінеді. Науқастарда субпопуляциялардың сипаттамалары цитокиндердің аралас медиаторлар спектрлерімен анықталады және өкпе мен бронхта әртүрлі нұсқада қабынулар туғызады, олар: аллергиялық, инфекциялық-қабынулар және аутоиммунды. Бронх демікпесі кезінде иммунологиялық қайта құрылу Tx-2 механизмінің активациясымен байланысты [7].

Жұмыс мақсаты:


  • Қан сарысуының құрамындағы иммуноглобулин Е (Ig E) мөлшері мен интерлейкин -2-нің 4 және 9 жас аралығындағы балалар бронх демікпесі кезінде салыстырмалы түрдегі көрсеткіштерін анықтау.

Зерттеу материалдары мен әдістері

Ақтөбе қаласы бойынша 4 және 9 жас аралығындағы бронх демікпесімен ауыратын балалардың қан сарысуындағы ИЛ-2 нің иммуноферментті анализ (ИФА) әдісі бойынша Pro Con IL-2 реагенттерін қолдана отырып анықталды. Ig E жалпы мөлшерін ИФА әдісі бойынша “ИФА набора Labodia-Хема для определения общего Ig E” анықталды. (г. Санкт-Петербург)



Зерттеу нәтижелері

  • Ақтөбе қаласындағы 4 және 9 жас аралығындағы бақылау тобындағы балалардың Ig E мөлшері 20-90 ME/мл аралықта, ал орташа мөлшері -58,0 ME/мл. Бронх демікпесімен ауыратын балаларда Ig E мөлшері 100-918 ME/мл аралықтa, ал орташа мөлшері -363.03 ME/мл артқан. Біздің алған мәліметтер бойынша науқас балалар мен бақылау тобындағы балалардың Ig E орташа мөлшерін салыстырғанда ауру балалардың Ig E мөлшері 6.2 есе ME/мл болып шықты.



  • ИЛ-2 мөлшері бронх демікпесімен ауыратын балаларда-18,6-24,6 аралықта, ал орташа мөлшері-20,5. Бақылау тобындағы балаларда Ил -2 мөлшерінің көрсеткіші - 8,0 -12,8 аралықта, ал орташа мөлшері -9,6 тең болды. Біздің алған мәліметтер бойынша науқас балалар мен бақылау тобындағы балалардың ИЛ -2 орташа мөлшерінің көрсеткіші 2,1 есе көп болды.

Пайдаланған әдебиеттер:

  1. Бэрнс П., Саймон Г. Бронхиальная астма. С.-П., 2003.- С. 26-28.

  2. Байжанова М.М.,Фактор риска развития бронхиальной астмы у детей // Материал 9 съезда педиаторов России Москва, 2001,60с.

  3. Байжанова М.М. Патологические основы лечения бронхообструктивного синдрома у детей // Дис. … д.м.н. – Алматы, 2003. – 50 с.

  4. Скучалина Л.Н. Бронхиальная астма у детей: автореф. … док. мед. наук.- Астана, 2005.-39 с.

  5. Маршалкина Т.В. Клиническое значение интерлейкинов 2 и 4 в патогенезе обструктивных заболеваний легких у детей: дис. … канд. мед. наук. – Алматы, 2001, - С. 146-150.

  6. Фрейдин М.Б. Роль интерлейкинов и их рецепторов в формировании предрасположенности к атопической бронхиальной астме: автореф.… канд. мед. наук:. Томск, 2001. – С.25-29.

  7. МаршалкинаТ.В., Байжанова М.М., Общность иммунологичных механизмов патогенезе рецидивирующего обструктивного бронхита и бронхиальной астмы // Дни иммунологии в Санк-Петербуге.5 Научная конференция с международным участием, Россия, Санкт-Петербург, 2001











ӘОЖ 619:616.15:636.2


ЛЕЙКОЗДЫҢ ДИАГНОСТИКАСЫНДА РЕКОМБИНАНТТЫҚ Р24 АНТИГЕНІ НЕГІЗІНДЕ ИММУНДЫҚ ФЕРМЕНТТІК ТАЛДАУДЫ ЖҮРГІЗУ

Есетова А.А., Ұқбаева Т.Д., Мукантаев Қ.Н.

Л.Н.Гумилев атындағы Еуразия ұлттық университеті

Астана қаласы, Қазақстан Республикасы, assel-bt@mail.ru

Ірі қара мал лейкозы дамыған сүтті мал өсіруде таралған аурулардың арасында көш бастауды жалғастыруда. Ірі қара мал лейкозы вирусының (ІҚМ ЛВ) ашылуының арқасында 90-шы жылдардың басынан серологиялық зерттеулерді қолданып келеді. Ғылым дамуымен басқа да әдістер арқылы анықтау жүргізілуде. Негізінен осы уақытқа дейін полимераздық-тізбектік реакция арқылы молекулалық-биологиялық зерттеулер жүргізілуде [1].

  Ірі қара мал лейкозы – табиғаты жағынан ісік ауруларына жататын созылмалы инфекциялық ауру, оның негізгі белгісі – ісік туындайтын немесе осы жасушалармен мүшелердің диффуздық инфильтрациясы өтетін қан түзуші мүшелердің жасушаларының жетілуінің бұзылуымен қатерлі ісіктік ұлғаюы [1, 2].

Жануарлар лейкозын дерлік барлық мемлекеттерді анықтайды. АҚШ-та, Орталық Еуропаның бірқатар мемлекеттерінде, Данияда, Швецияда және Таяу Шығыс елдерінде аса кең таралған.

Ауру жұқтырылған жануарлардың өнімділігінің төмендеуімен, шаруашылықта пайдалану мерзімінің шектелуімен, лейкозға қарсы шараларды өткізуге шығындардың шектеулігімен, сүтті залалсыздандырумен байланысты ауыл шаруашылық мекемелерге елеулі экономикалық шығын әкеледі.

ІҚМ ЛВ алғаш рет Ferrer 1974 жылы ашты. Ол ірі қара мал лейкозының этиологиялық агенті болып табылады және Bovine Leukemia virus (BLV) деп аталады. Экзогенді вирус болып табылады, Retroviridae тұқымдасы, Oncornavirinae тұқымдас тармағына жатады. Адамның Т-жасушалық лейкозымен қатар ІҚМ ЛВ Е типімен белгіленген ерекше топқа жатады. ІҚМ ЛВ вириондары мажорлық полипептидтерден (р10, р12, р15, р24, р30 және р64 КД) және гликопротеидтерден (gp30, gp51) тұрады. Р15, р24 және gp51, сондай-ақ ревертаза ферменті жануарлардың басқа онковирустарының вириондық ақуыздарымен ортақ антигендік детерминанттарға ие болмайды [3].

Лейкоздың қазіргі заманғы тиімді диагностикасы мәселесі осы уақытқа дейін аса тиімді нәтижеге жеткен жоқ. Қазіргі таңда ветеринарияда бірнеше әдістерді қолданады.

Иммундық диффузия реакциясы (ИДР) – ІҚМ лейкозы диагностикасының негізгі әдісі. Әдіс вирусқа антидене анықтауға негізделген және жоғары арнайылық кезінде аса төмен сезімталдылыққа ие. Бұл әдіспен барлық жұқтырылған жануарларды әр уақытта анықтауға болмайды, 6-айлық кезге дейінгі жас малдарды зерттеу мүмкін емес.

Иммундық ферменттік талдау (ИФТ) ИДР әдісімен салыстырғанда үлкен сезімталдылыққа ие, алайда қан сарысуында антиденелер жұқтырудан кейінгі 1,5-2 айдан кейін ғана анықталады. Сондықтан, біздің мақсатымыз – рекомбинанттық р24 антигені негізінде осы әдістің сезімталдылығын арттыру [4].

Полимераздық-тізбектік реакция әдісінің нәтижелілігі жоғары болғанымен, зерттеу қымбаттығымен байланысты «қымбат» әдістер қатарына жатады.

ІҚМ ЛВ жұқтырылған жануарлар бірнеше вириондық антигендерге антидене шығарады. Алғаш рет цитоплазмада ірі қара мал лимфоциттерін өндіретін вирус бұл вирус антигендерін анықтау үшін ірі қара мал лейкозымен науқастың сарысуын қолданумен тікелей емес иммундық флюоресценция әдісі қолданылды. Ары қарай осы әдіспен анықталатын антиген бас ішкі вириондық р24 ақуызында болатын антигендік детерминанттар таситын вириондық құраушы екендігі көрсетілді [5].

Лейкозбен науқас сиырлардың қан сарысуында төрт вирустық полипептидке бағытталған антиденелерді комплемент-байланыстырушы антиденелер анықталды: р15, р24, gp30 және gp51.

ІҚМ ЛВ-инфекциялар диагностикасы үшін иммундық флюоресценция реакциясы, комплементті байланыстыру реакциясы, кері транскриптазаны тежеу реакциясы, иммундық ферменттік талдау және псевдотипті бейтараптау реакциясы тәрізді бірқатар серологиялық реакциялар жасалынды.

Аталған әдістердің арасында аса сезімтал әдістерге иммундық ферменттік талдау болып табылады [6]. Лейкоздық жануарлардың лейкоциттерінің қысқа мерзімді дақылдарының дақылдық сұйықтықтығын ультрацентрифугалау әдісімен тұнбаланған, сахароза тығыздық градиентінде тазартылған және эфирмен өңделген вирустан антиген алады. Осы антиген арқылы ІҚМ ЛВ жұқтырылған жануарлардың қан сарысуында р24 вирусының ішкі полипептидіне преципитациялаушы антиденелерді анықтайды.

АҚШ-та, Бельгияда ірі қара мал табындарында энзоотикалық лейкозды кең ауқымды анықтау үшін моноклондық антиденелерді қолданумен ИФТ әдісі қолданылады. Ірі қара мал лейкозының диагностикасы кезінде ИФТ әдісі серологиялық диагностикасы сезімталдылығын елеулі арттырады. Ол сауыққан шаруашылық сирыларынан сүтті жүйелі бақылау үшін қолайлы [7].

Моноклондық антиденелермен ИФТ бір табын жануарларынан біріктірілген қан сарысу пулымен қояды.

Сиырлар уызында антиденелердің болуымен ІҚМ ЛВ жұқтырылуын ИФТ арқылы анықтау ұсынылған. Антиденелері бойынша сарысулардағы вирусқа позитивті науқас сиырлардан алынған сүттің барлық үлгілері оң болып шықты.

Осылайша, агар гелінде ИФТ 100 есе сезімтал болды. Берілген бағытта иммундық ферменттік талдауды жүргізу үшін рекомбинанттық р24 антигені негізінде сезімталдылығын арттыру мақсатымен жедел диагностикалық тест-жүйесін өңдеу жұмыстарын жүргізіп жатырмыз. Бұл мақсатта зертханалық тышқандарды ІҚМ ЛВ жұқтырып, периодты түрде қан алып тексеру жүргізіліп жатыр.



Әдебиеттер тізімі:

  1. Диагностика вирусных болезней животных: Справочник/ Сюрин В.Н. и др.- М.: Агропромиздат, 1991.-258 б.

  2. Бакулов И.А., Книзе А.В., котляров В.М., Дмитренко Н.В., Коломыцев А.А., Яременко Н.А. Система мониторинга особо опасных экзотических и малоизученных, в том числе зооантропонозных, болезней животных //Порокв. ВНИИВВиМ. - 2001. - 72 с.

  3. Lini S. Leucosis bodina enzootica //Profes-sioneallevatore. 1990. - N 17. - C.8-9.

  4. Эрнст Л.К., Коромыслов Г.Ф., Замараева Н.В., Гулюкин М.И. и др. Изучение иммуногенных и инфекционных свойств вируса лейкоза крупного рогатого скота на трансгенных кроликах //Бюлл. ВИЭВ. М. - 1996. -Вып. 77.-С.45.

  5. Таубекова Г.К., Искуллаев А.И. Эпизоотология лейкоза крупного рогатого скота в Казахстане //проблемы адаптации сельскохозяйственных животных в Сибири. Новосибирск, 1995. - С.52-56.

  6. Петров Н.И. Сравнительная оценка систем в проведении оздоровительных мероприятий от лейкоза крупного рогатого скота в племенных хоязйствах //Бюл.ВИЭВ. 1988. - Вып.67. - с.73-75.

  7. Островская Л.П., Лемеш В.М. Серологические и гематологические исследования крупного рогатого скота в неблагополучных по лейкозу хозяйствах //Вет.Наука-пр-ву.1989.-27.-с.31-34.

УДК 575.113:572.95

Анализ Y-STR в Y-хромосоме у казахов

Молдыбаева Б.Н., Жолдыбаева Е.В.

Евразийский национальный университет им. Л.Н. Гумилева, Национальный Центр Биотехнологий Республики Казахстан, Астана, Казахстан

E-mail: bahaenu.303@mail.ru
В настоящее время актуальным представляется детальное изучение генетической структуры различных этнических групп с целью выявления их особенностей. Одним из основных подходов к изучению структуры генофондов современных популяций и генетической истории их формирования является анализ гаплогрупп Y- хромосомы, составляемых на основании генотипирования набора ДНК-маркеров ее нерекомбинирующей части.

Целью работы являлось изучение Y-STR в исследуемой популяции.

Генотипирование проводилось с помощью стандартных молекулярно-генетических методов. Геномную ДНК выделяли из венозной крови с помощью набора Wizard® genomic DNA Purification Kit, фирмы Promega в соответствии с протоколом изготовителя. Количественное содержание ДНК проводили на спектрофотометре (Nanodrop 1000), а также оценивали с помощью электрофореза в 1 % геле, приготовленном на трис-ацетатном буфере. Фрагментный анализ проводили на основе набора AmpF&TR®Yfller, Applied Biosystems. Набор для ПЦР-амплификации AmpFlSTR® Yfiler™ представляет собой тест-систему для исследования коротких тандемных повторов (STR), позволяющую амплифицировать 17 локусов STR Y-хромосомы (DYS: 389I, 389II, 390, 456, 19, 385, 437, 438, 448, 391, 392, 393, 35, 458, 439, GATA H4) в одной реакции ПЦР. Флуоресцентномеченные ампликоны разделялись в 16-капилярном генетическом анализаторе 3130 xl Genetic Analyzer. Полученные данные обрабатывались с помощью программного обеспечения GeneМapper 4.0, статистический анализ проводился с помощью программы Arlequin 3.512, используя приложение AMOVA были высчитаны генетические расстояния Фst. Дискриминирующую способность высчитывали по формуле D=Ndiff/N, где Ndiff/ - это число различных генотипов популяций и N - размер популяции.

В результате анализа распределения аллелей 17 локусов нерекомбинирующей части Y-хромосомы у 67 индивидов, представляющих этнических казахов из Восточно-Казахстанской области, Тарбагатайский район (с.Карасу, с.Кабанбай, с.Акжар) был определен цифровой код для каждого образца. Среди исследованных образцов было выявлено 27 (40%) различных генотипов. Нужно отметить, что у 41 человека был обнаружен одинаковый генотип.

Полученные результаты сравнивали с мировой базой (http://www.yhrd.org) и с данными представленными в статье A.Z. Biro et. al. 2009, в которой была изучена популяция казахов из Тургайской области. Сравнительный анализ не выявил одинаковые гаплотипы. Генетические расстояния между исследуемой популяцией и казахами из Тургайской области составили 0,63±0,07. В настоящее время продолжаются исследования по изучению генофонда казахов на основе Y-хромосомы.

УДК 576.858:616.36-002


Определение лекарственной устойчивости к противовирусным препаратам вируса гепатита В, циркулирующего в городе Астана

Кравченко А.П., Шевцов А.Б.

Евразийский национальный университет им. Л.Н. Гумилева,

Национальный Центр Биотехнологий РК, Астана, Казахстан

alena.2989@mail.ru
Хронический гепатит В является серьезной глобальной проблемой общественного здравоохранения. В настоящее время для лечения хронического гепатита В на ряду с интерфероном применяется ряд нуклеоз(т)идных препаратов. Серьезной проблемой применения нуклеоз(т)идных аналогов является развитие к ним резистентности вследствие мутаций в полимеразном гене. В настоящее время мутация M204V/I/S является основной и определяет резистентность вируса к ламивудину. При лечении адефовиром описаны две основные мутации, определяющие резистентность к адефовиру, – N236T (замена аспарагина[N] на треонин[T] в позиции 236 D-региона обратной транскриптазы) и A181V (замена аденина[A] на валин[V] в позиции 181 В-региона обратной транскриптазы вируса). Кроме того, выделяют целый ряд других мутаций (L80V/I, V84M, V214A, S85A Q215S, P237H и N238T/D), которые сочетаются с одной из основных, или, реже – встречаются изолированно . При лечении энтекавиром описано развитие ряда специфичных для препарата мутантных штаммов – T184S/A/I/L, S202G/C и M250I/V в регионах В, С и Е обратной транскриптазы вируса соответственно, а также мутаций, характерных для лечения ламивудином – M204V/I/S и L180M. При лечении телбивудином описано развитие мутаций, аналогичных при использовании ламивудина – M204I, L180M и L80V/I, поэтому между обоими препаратами существует перекрестная резистентность. Определение лекарственной устойчивости обеспечивает правильную стратегию лечения, профилактику резистентности и своевременную модификацию схемы лечения с учетом перекрестной резистентности.

Нашей главной целью являлось определение лекарственной устойчивости вируса гепатита В методом определения нуклеотидной последовательности полимеразного гена. Амплификацию фрагмента полимеразного гена проводили по методике, предложенной D. Vincenti (2009), с последующим секвенированием, что также нам позволило изучить распределение генотипов вируса гепатита В в г.Астана.

В исследование было включено 37 образцов ДНК с титров вируса гепатита B не ниже 2*103 МЕ/мл. Образцы ДНК были предоставлены СЭС г.Астана. Филогенетический анализ с референтными последовательностями вируса гепатита В различных субтипов позволил классифицировать наши образцы как: генотип D1- 23 образца, генотип D2-5 образцов, D3-6 образцов, а также к генотипу С1-1 образец и С2- 2 образца. В ходе анализа полимеразного гена 37 образцов, в двух образцах, в которых установлен генотип D2, была обнаружена rtV214A мутация, характерная для лекарственной устойчивости к адефовиру.

В заключение, на территории г. Астана преобладает генотип D вируса гепатита В. В исследуемых образцах выявлена всего одна мутация rtV214A, обуславливающая устойчивость к адефорину, что возможно связано с ограниченностью выборки. Для лучшего понимания циркуляции генотипов и генотипической резистентности вируса гепатита В на территории Республики Казахстан необходимы дальнейшие исследования с большим количеством образцов и сведений о применяемой терапии.



Примечание: Авторы выражают благодарность сотрудникам вирусологической лаборатории СЭС г.Астана за оказание помощи в исследовании

Научный руководитель – д.б.н., профессор, Омаров Р.Т.

УДК: 576.8.097.3:616.248.



Роль сывороточного маркера апоптоза sFASL в развитии бронхиальной астмы

Омарова А.А., Казахстан, г. Астана, ЕНУ им. Л.Н.Гумилева,

Бронхиальная астма является мультифакториальным заболеванием, которым страдает более 300 млн. человек, что составляет от 5 до 15% населения в разных странах, по данным Всемирной Организации Здравоохранения (ВОЗ). В настоящее время вызывает обоснованную тревогу большой процент инвалидности, включая смертность больных бронхиальной астмой, а также размеры экономического ущерба, связанного с заболеваемостью бронхиальной астмой [1].

Согласно современным представлениям, бронхиальная астма (БА) – (от греч. asthma - удушье) [2] - заболевание, в основе которого лежит аллергическое воспаление бронхов, обуславливающее повторяющиеся эпизоды бронхиальной обструкции и гиперреактивность дыхательных путей [3]. Воспалительная природа заболевания (БА), обусловленная воздействием специфических и неспецифических факторов, проявляется морфологическими и функциональными изменениями во всех структурах стенки бронхов. При этом наблюдаются повреждение и десквамация эпителиальных клеток, дезорганизация и склерозирование субэпителиальной части базальной мембраны, а также гипертрофия гладких мышц, инфильтрация стенки бронха эозинофилами, тучными клетками и Т-лимфоцитами. Длительный воспалительный процесс способен привести к необратимым морфологическим изменениям в виде резкого утолщения базальной мембраны с нарушениями микроциркуляции и развитием склероза стенки бронхов [4,5].

Бронхиальная астма относится к группе заболеваний, где важную роль в регуляции клеточного баланса иммунокомпетентных клеток играет апоптоз. Апоптоз представляет собой высокорегулируемую форму программированной клеточной гибели с характерными морфологическими, биохимическими и генетическими признаками, в результате которой достигается конечная цель - гибель клетки. Апоптоз рассматривают как необходимое условие поддержания гомеостаза на клеточном, тканевом и органном уровнях [6], вследствие поддержания постоянства численности клеток, соотношения различных клеточных субпопуляций и элиминации дефектных клеток [7]. Факторы, оказывающие влияние на запуск процессов апоптоза, весьма многочисленны и разнообразны [8]. Одним из внешних факторов, запускающих в клетке апоптоз, является лиганд белка CD95 (Fas/APO-1) - Fas-лиганд [9]. При связывании лиганда с Fas- рецептором происходит активация каспазы 8 (pro-FLICE/MACHI/Mch5) [10], что активирует предшественник каспазы 1(pro-ICE). Активация каспазы 1(pro-ICE) повышает проницаемость митохондриальной мембраны за счет выделения в цитоплазму целого ряда апоптогенных факторов (цитохром С, каспазы 2 и 9, апоптозиндуцирующий фактор-АИФ и др.). Эти факторы самостоятельно (АИФ) либо в комплексе (цитохром С и АИФ) приводят к активации каспазы 3 (CPP32/Yama). Это влечет за собой активацию дальнейшей цепочки каспаз и эндонуклеаз, что является критерием необратимой фазы апоптоза и приводит к деградации ДНК [11].



Целью настоящего исследования явилось определение роли сывороточного маркера апоптоза sFASL в развитии БА.

Материалы и методы

Набор больных для исследования производился на базе пульмонологического отделения Онкологического диспансера г. Астаны. Диагнозы заболеваний устанавливались врачами пульмонологического отделения Онкологического диспансера на основании данных клинического и лабораторного обследования, спирографии, R-графии.

В исследование были включены 19 больных БА в возрасте от 14 до 68 лет с различной степенью тяжести: с легкой персистирующей астмой - 6 человек, среднетяжелой персистирующей астмой -8 больных, с тяжелой астмой -5 человек. В качестве группы контроля были взяты 12 практически здоровых лиц (без признаков аллергических, аутоиммунных, инфекционных и паразитарных заболеваний).

Вначале проводилось анкетирование больных бронхиальной астмой и лиц контрольной группы. Анкета включала в себя следующие разделы: основные данные (ФИО, возраст, пол, национальность, место проживания и место работы); образ жизни (вредные привычки: курение, употребление алкоголя и др.); степень тяжести БА (легкая интермиттирующая, легкая персистирующая, среднетяжелая, тяжелая форма заболевания); наличие отягощенной наследственности по аллергическим заболеваниям, получаемая терапия (ингаляционные и системные глюкокортикостероиды (ГКС), бронхолитики, антибиотики и др.).

Уровень суммарного IgE в сыворотке крови определяли с использованием диагностических наборов реагентов IgE-ИФА-БЕСТ-стрип производства ЗАО «Вектор-БЕСТ» (г. Новосибирск) методом иммуноферментного анализа.

Измерение концентрации sFasL в сыворотке крови проводили с помощью иммуноферментного набора (sFas (S) ELISA kit Code No. 5251, Medical & Biological Laboratories Co Ltd). Набор для sFas включал микропланшеты со специфичными сорбированными в ячейках антителами к sFas. Покрытые антителами ячейки дважды промывали 300µl Wash Buffer. В каждую ячейку наносили по 50µl коньюгата, меченного пероксидазой. После чего в ячейки наносили по 50µl образца, разбавленных Sample Diluent в соотношении 1:5 (для sFas). После 2-х часовой инкубации несвязавшийся конъюгат удаляли промыванием, в ячейки добавляли по 100µl коньюгата, содержащего вторичные антитела, меченные пероксидазой. Несвязавшийся конъюгат после 30-минутной инкубации удаляли промыванием. Затем к субстратному комплексу добавляли 100µl TMB Substrate Solution, который взаимодействуя с субстратным комплексом, образует окрашенный раствор. Ферментная реакция останавливалась добавлением 100µl Stop Solution. Интенсивность окраски, свидетельствующую о концентрации определяемого белка, измеряли с помощью Microplanshet Reader (BiolabSystem) при длине волны 450 нм. Статистическую обработку полученных результатов проводили с использованием критерия t Стъюдента. Различия между сравниваемыми группами и цифрами считали достоверными при р<0,05-0,01-0,001.



Результаты и их обсуждение

В сыворотке крови здоровых пациентов установлено низкое содержание белка – продукта гена-агониста апоптоза sFAS-L. Напротив, в сыворотке крови больных бронхиальной астмой обнаружен высокий уровень белка sFAS-L. У обследованных пациентов среднее содержание sFAS-L было ниже, чем в контрольной группе (0,16±0,02 и 0,21±0,02 соответственно), также наблюдалась сопряженность уровня sFAS-L с длительностью, периодом и тяжестью течения болезни.

При подготовке обзора литературы по данной теме мы не нашли сведений изучения содержания сывороточного маркера апоптоза (sFAS-L) у больных бронхиальной астмой в зависимости от клинической формы заболевания, наличия сопутствующей патологии, проводимой терапии, иммунологических показателей.

При анализе полученных результатов были сформированы 2 группы больных: с максимально высокими значениями и максимально низкими значениями sFAS-L.

В группе с повышенным уровнем sFAS-L наблюдалось достоверное повышение общего IgE (300 МЕ/мл). В группе с низкими значениями повышение sFAS-L отмечалась более тяжелая клиническая картина с большей потребностью в назначении глюкокортикостероидных препаратов и антибактериальных средств.

Таким образом, установлено, что sFAS-лиганд участвует в индукции апоптоза иммунокомпетентных клеток при БА. Известно, что Тh 1 – типа обладают более высокой способностью продуцировать FasL. Более того, повышенная чувствительность Тh1-клеток к антиген-индуцированному апоптозу, в отличие от Тh2-клеток, способствует длительному выживанию последних. Известно, что Тh2 ответственны за развитие гиперчувствительности немедленного типа, в то же время Тh2 имеют повышенный уровень экспрессии молекул CD30, что считается одним из факторов их большей устойчивости к апоптозу по сравнению с Тh1. В группе с повышенной индукцией апоптоза иммунокомпетентных клеток преимущественно регистрирована астма средней и тяжелой степени тяжести. У этих больных отмечался повышенный уровень нейтрофилов периферической крови и невысокие значения IgE, что может свидетельствовать о преобладании Тh1 иммунного ответа.

Таким образом, при бронхиальной астме наблюдается повышение сывороточного уровня sFAS-лиганда, что приводит к повышенному апоптозу Тh1-лимфоцитов и повышенной экспрессии Тh2-типа клеток, способствующих персистенции аллергического воспаления и характерным клинико-функциональным проявлениям заболевания.
Использованные источники


  1. Нестерович И.И.// Нарушения апоптоза клеток-мишеней при различных вариантах бронхиальной астмы// - Автореф. дисс. ... докт. мед. наук.-М:,. 2005. - 4с.

  2. http://www.lor-astma.ru/

  3. Т.Г. Решетова, А.И. Рывкин, Р.М. Ларюшкина, Н.С. Побединская, Вадаккаил Ассан, Е.Н. Андрианова, Е.Е. Стеблецова, О.В. Кузнецова // Сравнительная эффективность применения комбинированной терапии при бронхиальной астме у детей.- Аллергология. – 2003.

  4. Чучалин А.Г. Национальная программа России по борьбе с бронхиальной астмой, Materia Medico. Бюллетень для врачей и фармацевтов, 1998, N2, том 18, с. 3-7.

  5. Busse W.W., Calhoun W.E, Sedgwick J.D. Mechanism of airway inflammation in asthma, Am Rev Respir Dis, 1993, v. 147, p. 20-24.

  6. Т.В. Мамонтова, И.П. Кайдашев. // Новые аспекты апоптоза мононуклеарных клеток в патогенезе атопической бронхиальной астмы.- Аллергология.-2005.

  7. Banki K., Gonchoroff N., Perl A., Elevation of mitochondrial transmembrane potential and reactive oxygen intermediate levels are early events and occur independently from activation of caspases in Fas signaling // J.Exp.Med.- 1995.-Vol.182.-P.367-377.

  8. Ярилин А.А.//. Пат. физиология.- 1998.-№2.-С. 38-48.

  9. http://www.medbiol.ru/medbiol/angiogenin/00009455.htm

  10. Boldin M.P., Goncharov Y.V. et.al.// Cell.- 1996.-Vol.85.-P.803-815.

  11. Heberstreit H., youseft S.et.al.// Eur.J.immunol.-1996.-Vol.26.-P.1775-1780.

Научный руководитель – кандидат медицинских наук, Акпарова А.Ю.

УДК 575.113: 616.248


РОЛЬ ПОЛИМОРФИЗМА ГЕНА ФЕРМЕНТА БИОТРАНСФОРМАЦИИ КСЕНОБИОТИКОВ GSTP1 В ПРЕДРАСПОЛОЖЕННОСТИ К БРОНХИАЛЬНОЙ АСТМЕ

Суртаева А.К.

Евразийский Национальный университет им. Л. Н. Гумилева, г. Астана, Казахстан

e-mail: aika_sk90@mail.ru
Бронхиальная астма (БА) по-прежнему остается одной из актуальных проблем здравоохранения. В некоторых странах она является главной причиной инвалидизации и смертности населения, опережая даже сердечнососудистые и онкологические патологии [1]. Ее частота в различных популяциях мира колеблется от 4 до 10% [2, 4]. БА – хроническое воспалительное заболевание дыхательных путей, основным и обязательным патогенетическим механизмом которого является изменённая реактивность бронхов, обусловленная специфическими иммунологическими (сенсибилизация и аллергия) или неспецифическими механизмами, а основным (обязательным) клиническим признаком является приступ удушья вследствие бронхоспазма, гиперсекреции и отёка слизистой оболочки бронхов [2].

БА является примером многофакторной патологии, возникающей в результате сложного взаимодействия многочисленных факторов окружающей среды и наследственной предрасположенности [3]. Многочисленные факторы внешней и внутренней среды воздействуют на геном, формируя неблагоприятный наследственный фон, реализующийся при взаимодействии с факторами среды патологическим фенотипом.

Ферменты биотрансформации ксенобиотиков играют важную роль в течении бронхо-легочных заболеваний благодаря участию в антиоксидантных реакциях и детоксикации внешнесредовых полютантов, стимулирующих развитие воспалительного процесса вследствие токсического и раздражающих эффектов. Большая роль среди них принадлежит ферментам глутатион-S-трансферазам [5].

Ген GSTP1 локализован на хромосоме 11 (11q13). Для гена GSTP1 описана точковая мутация: замена аденина на гуанин в 313 положении первичной последовательности GSTP1, проявляющейся заменой изолейцина 105 на валин (Ile105Val) в 5 экзоне. При мутации 105Val в 7 раз увеличивается каталитическая активность фермента по отношению к полициклическим ароматическим соединениям, но в 3 раза снижена активность по отношению к 1-хлор-2,4-динитробензену [6].

Целью работы явился анализ ассоциации полиморфных вариантов гена фермента биотрансформации ксенобиотиков GSTP1 с развитием БА.
Материалы и методы

Для установления связи между исследуемыми маркерами и бронхиальной астмой были выбраны больные пульмонологического отделения Онкологического диспансера г. Астаны. Диагнозы заболеваний устанавливались на основании данных клинического и лабораторного обследования, спирографии, R-графии. В исследование включено 27 больных бронхиальной астмой от 17 до 72 лет.

В качестве контроля была обследована выборка лиц, состоящая из 24 практически здоровых лиц, не курящих, сопоставимых по возрасту с больными людьми.

Полиморфизм гена GSTР1, был исследован методом ПДРФ. Смесь для амплификации объемом 25 мкл включала 100 мМ трис-HCL буфера (рН 8,8), 2 мМ МgCl2, 10' пМ каждого праймера (5- GTAGTTTGCCCAAGGTCAAG -3’ и 5- AGCCACCTGAGGGGTAAG -3’), 0.2 мМ каждого dNTP и 0.05 ед/мл Taq-полимеразы (Fermentas).

Продукты амплификации фракционировали 40 минут в 3% агарозном геле на ТАЕ-буфере при напряжении 130 В. Фрагменты ДНК окрашивали бромистым этидием и визуализировали в ультрафиолетовом свете. После амплификации ПЦР-продукты подвергались гидролизу эндонуклеазой рестрикции Ava26I (Fermentas).

Для анализа ассоциации маркеров исследуемых генов сравнивали частоты аллелей и генотипов в группах больных и здоровых индивидов, используя критерий χ2. Об ассоциации разных генотипов с заболеваниями судили по величине отношения шансов (odds ratio – OR). Уровень значимости (Р) определяли с использованием стандартного метода χ2 для оценки достоверностей различий между частотами вариантов GSTР1 в группах больных и контроле.



Результаты и обсуждение

При сравнении групп больных БА и здоровых индивидов были выявлены статистически достоверные различия между генотипами ile/ile, ile/val и val/val гена GSTP1. Анализ полиморфизма гена GSTP1 показал ассоциацию генотипа val/val c развитием БА (χ2= 6,66 при df=1, р=0,01) (таблица 1).



Таблица 1 – Относительный риск влияния полиморфизма гена GSTР1 на развитие бронхиальной астмы в казахской популяции

Гены

Генотип

БА, чел (%)

n=27


Контроль, чел (%)

n=24


OR

CI (95%)

χ2

Р

GSTР1

ile/ile

2(0,074)

6(0,250)

0,24

0,04-1,33

6,66


0,01



ile/val

9(0,333)

12(0,500)

0,50

0,16-1,55

val/val

16(0,593)

6(0,250)

4,36

1,31-14,51

Среди глутатион-S-трансфераз изофермент Р1 наиболее активен, поэтому полиморфизм гена GSTР1 способен заметно изменять активность ферментов биотрансформации ксенобиотиков [7]. По данным зарубежных исследователей отмечена ассоциация хронических обструктивных заболеваний легких с аллелем 105Ile у больных из Японии[8], у больных из Великобритании была обнаружена ассоциация с аллелем 105Val [9], в то же время у больных корейцев такой ассоциации не выявлено Также было показано, что при длительном воздействием озона на дыхательную систему здоровых молодых людей, у мужчин – носителей генотипа Val/Val в 105-м положении гена GSTР1 повышен риск развития функциональных нарушений легких [10].

Таким образом, при анализе результатов исследования выявлена ассоциация генотипа Val/Val гена GSTP1 c развитием БА.



Список литературы


  1. Jarvis D., Burney P. Epidemiology of atopy and atopic diseases // Allergy and allergic diseases / Ed. A. B. Kay. – Blackwell Science, Oxford, 1997. – P. 1208-1224.

  2. Чучалин А.Г. Бронхиальная астма. - М.,1995.

  3. Федорова Ю.Ю. Анализ генов предрасположенности к развитию бронхиальной астмы в Республике Башкортостан. Автореф. дис. канд. биол. наук по спец. 030015 – генетика. Уфа, 2009.- с.3.

  4. Бронхиальная астма у детей. Стратегия лечения и профилактика // Под редакцией Балаболкина И.И.-М.,1998.

  5. Тиуров Л. А., Иванова В. А. Роль глутатиона в процессах детоксикации // Вест. АМН СССР. – 1988. - №1. – С. 642-645.

  6. Викторова Т.В., Корытина Г.Ф., Янбаева Д.Г. Взаимодействие генетических и внешнесредовых факторов в процессе развития хронических обструктивных болезней легких. Медецинская генетика. 2003. – Т.2. №2. – С. 50-59.

  7. Моисеев А.А., Хрунин А.В., Павлюшина Е.М., Пирогова А.Н., Горбунова В.А., Лимборская С.А. Полиморфизм глутатион-S- трансфераз и результаты химотерапии рака яичников. Вестник РОНЦ им. Н.Н. Блохина РАМН. 2008.- Т.19. №1.- С. 59-62.

  8. Ishii T., Matsuse T., Teramoto S. et al. Glutathione S – transferase P1 (GSTP1) polymorphism in patients with chronic obstructive pulmonary disease // Thorax. 1999. V. 54. P.693 - 696.

  9. Sandford A.J., Silverman E.K. Chronic obstructive pulmonary disease. 1: Susceptibility factors for COPD the genotype – environment interaction // Thorax . 2002. V. 57. N.8. P. 736-741.

  10. Chen C, Arjomandi M , lager LB. el al. Effects of antioxidant enzyme polymorphisms on ozone – induced lung func­tion changes. Eur Respir J 2007; 30: 677-683.


Научный руководитель – кандидат медицинских наук, Акпарова А.Ю.

Секция «Современная биотехнология»

УДК 633.11:631.52.581



Сәбіздің өзектік паренхимасының

каллусогенез белсенділігі

Алмаганбетов Ж.С., Мурсалимов А.А., Жанаева А.Б.

әл-Фараби атындағы Қазақ Ұлттық университеті, Алматы, Қазақстан

Өсімдік клеткасына тотипотенттік қасиет тән. Тотипотенттік дегеніміз – жекешеленген клеткалардың көбейе өсіп, толыққанды бүтін организмге айналу қабілеті. Көп клеткалы организмдердің әр клеткасында толық нәсілдік мағлұматтар жиынтығы болады. Тотипотенттік осыған негізделген. Кез келген өсімдіктің оқшауланып алынған мүшелері мен ұлпаларын қолайлы жағдайда өсіргенде олардан маманданбаған клеткалар тобы-каллус түзіледі. Каллус деп клеткалардың пролиферациялану нәтижесінде түзілген ұлпаларды айтады. Дедифференциация процестің негізінде гендердің диференциалды белсенділігі жатады. Клеткалардың құрылымы мен қызметі гендердің ырықтығына байланысты. Организмдегі клеткалардың құрылымы мен атқаратын қызметінің өзгеруіне себепші әр түрлі гендердің экспрессиясы болып табылады. Яғни, клеткалардың мамандануы көптеген гендердің әрекеттесуіне байланысты. Организмнің барлық клеткалардында гендері бірдей болса да олардың бәрі бір мезгілде әрекеттенбейді. Әдетте гендердің біразы ғана (5 %) белсенді болады.

Біздің зерттеу жұмысымыздың мақсаты сәбіздің өзектік паренхимасының каллусогенез белсенділігіне 2,4 Д мен казеин гидролизатының тигізетін әсерін зерттеу болып табылды.

Қоректік орта ретінде Мурасиге-Скуг (МС) ортасы дайындалды. Орталардың құрамына мг/л 2,4 Д; 1 мг/л 2,4 Д + 100 мг/л казеин гидролизаты; 2 мг/л 2,4 Д қосылды. Экспланттарды каллус ұлпасы түзілгенге дейін температурасы 25±20С, қараңғы камераға орналастырады. Ауаның ылғалдылығы 55-60 % болуы тиіс.

Зерттеу жұмысының нәтижесінде экспланттардың каллус түзу қабілетіне 1 мг/л 2,4 Д + 100 мг/л казеин гидролизаты қосылған орта оптималды болды. Бұл ортада каллустың түзілу белсенділігі 100±0,9 % құрады. Ал казеин гидролизаты қосылмаған орталарда (1 - 2 мг/л 2,4 Д) каллусогенез белсенділігі төмен, яғни 65±0,6 %, 60±0,5 % болатыны анықталды. Тәжірибе варианттарына қарағанда бақылау ортасында (гормонсыз МС ортасы) каллус түзу белсенділігі анағұрлым төмен, яғни 49±0,4 % құрады.

Тәжірибе варианттарында каллустардың түзілуі 2-ші аптада басталды. Бақылаудың 4- 6 –ші апта аралығында каллустардың өсу қарқындылығы жоғарылап, ал 7-ші аптада олардың өсу қарқындылығы стационар фазаға көшті. Тәжірибе варианттарын өзара салыстырғанда казеин гидролизаты қосылған ортада каллустырдың өсуі қарқынды жүрді. Ал бақылау вариантында каллустың түзілу белсенділігі 3-ші аптаның басында байқалды, сондай-ақ олардың өсу белсенділігі баяу жүрді.

Түзілген каллустар қоректік ортаның құрамына қарай өзара (түсі, ылғалдылығы, тығыздығы) бойынша ерекшеленді. Гормонсыз МС ортасында: каллус сарғыш-сұр, құрғақ, тығыз; 1 мг/л 2,4 Д қосылған МС ортасында сарғыш-жасыл, борпылдақ, түйіршікті, арасында қызғылт-қоңыр аудандары бар, орташа ылғалды; 1 мг/л 2,4 Д + 100 мг/л казеин гидролизаты қосылған ортада түзілген каллус ұлпалары сарғыш-жасыл, шашыраңқы, орташа ылғалды; 1 мг/л 2,4 Д қосылған МС ортасында түзілген каллус ұлпалары сары, орташа тығыз, орташа ылғалды қасиетке ие болды.

Қорыта айтқанда, сәбіздің өзектік паренхимасының каллусогенез белсенділігіне 1 мг/л 2,4 Д + 100 мг/л казеин гидролизаты қосылған МС ортасы оптималды әсер етті.


Ғылыми жетекші - б.ғ.к., доцент Асрандина С.Ш.

УДК 622.276.43


ИССЛЕДОВАНИЕ ВОЗМОЖНОСТИ ВНУТРИВИДОВОГО ПЕРЕНОСА ДНК ОТ КОНТРОЛЬНЫХ РАСТЕНИЙ СОИ И РАПСА МЕТОДОМ SSR АНАЛИЗА

Бердыбекова А.Б., Балпанов Д.С., Талжанов Н.А.

ТОО «Научно-аналитический центр «Биомедпрепарат», г. Степногорск, РК, biomedpreparat@bk.ru
Потенциальное воздействие генетически модифицированных организмов на
окружающую среду является одним из обсуждаемых вопросов на сегодняшний
день. Возделывание генетически модифицированных растений на сельскохозяйственных угодьях наряду с традиционными культурами, в непосредственной близости от которых произрастают близкородственные дикорастущие виды, со временем может привести к образованию их гибридов. Такие гибриды, обладая устойчивостью к стрессовым факторам, переданным за счет интрогрессии трансгенных признаков, по сравнению с другими растениями в агроценозе имеют преимущества при естественном отборе. Таким образом, существует угроза вытеснения традиционных сортов данной культуры и исчезновения аборигенных культур, составляющих основу органического земледелия. Поэтому при оценке риска неблагоприятных экологических эффектов ГМО анализируется сам трансгенный признак на предмет его адаптивности, а также вероятность его переноса, как к культурным растениям, так и диким сородичам. Исходя из выше изложенного, целью нашей работы явилось изучение внутривидового трансгеноза на примере самоопыляемой культуры сои и перекрестноопыляемой культуры рапса в полевых условиях.

Согласно закону «О семеноводстве», в Республике Казахстан запрещается выращивание ГМ культур. Поэтому в нашей работе в качестве объектов исследований выбраны традиционные сорта сои «Алматы» и «Жалпаксай» и рапса «Абилити», «Лизора» «Пионер F1», «Сальса CL F1». Данные сорта и гибриды характеризуются схожим вегетационным периодом.

На опытных участках Центра заложены полевые эксперименты по исследованию перекрестного опыления между двумя контрольными генотипами сои и рапса в зависимости от расстояния между ними. Для оценки возможного переноса фрагментов ДНК от контрольных растений посев сои сортов «Алматы» и «Жалпаксай» осуществлялся с междурядьем 15 см, 45см, 60 см, 70 см на расстояниях друг от друга в двух вариантах: с поливом и без полива. Сорта рапса «Лизора» и «Абилити» на участке с поливом разместили на расстояниях 15 см, 3 м, 10 м друг от друга. На расстоянии 4 км от промышленных плантаций рапса сортов «Абилити», «Пионер F1», «Сальса CL F1» на участке без полива площадью 3 га был произведен посев рапса сорта «Лизора».

В течение вегетационного периода на опытных участках проводились агротехнические мероприятия по уходу за растениями и фенологические наблюдения за посевами сои и рапса. Отмечена одновременность цветения и сортов рапса.

Отбор проб семян сои и рапса проводили методами сплошного и рендомизированного отбора с последующим формированием средних проб по вариантам. Для анализа отобрали 2184 и 515 проб семян сортов рапса и сои соответственно.

Осуществлен подбор методики по выделению геномной ДНК из семян растений. Для оценки возможного переноса фрагментов ДНК от контрольных растений были подобраны микросателлитные маркеры. Оптимизированы условия проведения ПЦР. Эффективность работы каждой пары праймеров и проб апробирована методом горизонтального электрофореза в 2% и 0,8% агарозном гелях соответственно.



УДК 637.146.34

БИОТЕХНОЛОГИЧЕСКИЕ МЕТОДЫ В ТЕХНОЛОГИИ ПОЛУЧЕНИЯ КОНЦЕНТРАТОВ КИСЕЛЕЙ ПРОФИЛАКТИЧЕСКОГО ДЕЙСТВИЯ

Егупова О.И., Гладкова И.А., Антипова Л.В., Успенская М.Е.

ГОУВПО «Воронежская государственная технологическая академия»

Воронеж, Россия, meatech@yandex.ru
Первое место в мире по показателям смертности в наши дни занимают сердечно-сосудистые заболевания. Правильное питание усиливает действие лекарств, повышает их эффективность, увеличивает продолжительность жизни больных. Кроме того, здоровое питание способствует профилактике сердечно-сосудистых заболеваний, при наличии факторов риска и наследственной предрасположенности.

Диета при заболеваниях сердечно-сосудистой системы должна содержать продукты богатые калием и магнием. Калий — противосклеротическое средство, применяется для профилактики нарушений деятельности сердечно-сосудистой системы, стимулирует мочеотделение и способствует выделению натрия, устраняя отеки. Соли магния оказывают антисептическое и сосудорасширяющее действие, понижают артериальное давление и содержание холестерина в крови. В рационах профилактического и корректирующего питания при нарушениях деятельности сердечно-сосудистой системы также необходимы продукты богатые биофлаваноидами, обладающие капилляроукрепляющим действием, т.к. уменьшают проницаемость сосудистой стенки. Доступными источниками биофлаваноидов можно считать зеленый чай, малину, плоды шиповника, лимон, черную смородину. Присутствие в рационе пищевых волокон, обеспечивает снижение уровня холестерина в крови, а, следовательно, улучшает состояние сосудов и организма в целом.

В связи с этим, на кафедре «Пищевой биотехнологии и переработки животного и рыбного сырья» ВГТА проведен эксперимент по разработке технологии концентратов киселей профилактического действия для людей с сердечно-сосудистыми заболеваниями, с применением декстринизированной овсяной муки. Замена традиционного картофельного крахмала на овсяную муку обусловлена более высокими показателями пищевой ценности последней. Содержание в ней отдельных пищевых веществ на 100 г продукта составляет: белков 13 г, пищевые волокна 4,5 г, крахмал 63,5 г, магний 110 мг, калий 280 мг. В качестве источников функциональных ингредиентов используется фитоэкстракты сборов лекарственных растений и плодов на основе молочной сыворотки. Учитывая физиологическую направленность фитокомпозиций, были выбраны сборы лекарственных растений и плодов в нескольких вариантах:

- противодиабетический, для коррекции содержания сахара в крови и улучшения обмена веществ, предполагающий сочетание листьев крапивы, черники и ягод бузины с травой хвоща, корнем одуванчика;

-кардиотонический, оптимизирующий артериальное давление, улучшающий деятельность сердечно - сосудистой системы, также оказывающий положительное влияние на работу пищеварительного тракта (плоды шиповника, черники, черноплодной рябины, корни аира).

- антиатеросклеротический, нормализующий и улучшающий кровообращение, кровоснабжение, укрепляющий стенки сосудов (цветы арники, травы зверобоя и тысячелистника)

- иммуномодулирующий, нормализующий деятельность сердечной мышцы, кроме того, характеризующийся общеукрепляющим и антистрессовым эффектом (плоды боярышника и шиповника, цветки календулы).

Нами изучены и оптимизированы условия, параметры и режимы получения молочно-растительных экстрактов. Для обеспечения положительных органолептических характеристик и оптимальной концентрации физиологически функциональных ингредиентов в фитоэкстрактах, установлено соотношение массы лекарственного сбора растений и экстрагента – молочной сыворотки 1:30.


Пастеризованная молочная

сыворотка, pH 4,0-5,0




Измельчение растительного сырья до размера частиц, от 0,71 до 1,5 мкм




Экстракция

t=60-65ºС; время-30 -40 мин.



Центрифугирование

6 тыс. об/мин,15 мин


Фильтрование




Пастеризация

t=72-75 С, время: 2-3 с

Рисунок – Технологическая схема получения молочно-растительных экстрактов

Для последующего применения экстрактов в качестве рецептурного компонента, их подвергают распылительной сушке 50-550С, до влажности 4-8%.

Изучение химического состава полученных экстрактов, подтверждает их высокую пищевую и биологическую ценность. Так, например, содержание калия в 100 г экстракта составляет 0,00184 - 0,00192 г (кардиотонический, антиатеросклеротический) при рекомендуемой суточной норме потребления 1,5-2 г., магния 20,6 - 72,7 мг (противодиабетический, антиатеросклеротический) при суточной норме потребления – 400мг. Немаловажным фактом является наличие в фитоэкстрактах микроэлементов: йода (противодиабетический, кардиотонический) до 140,6 мг (норма 150 мг в сутки), обусловленного присутствием плодов рябины черноплодной и хвоща полевого, железа 0,19-0,23 мг (норма 10-18 мг в сутки). В углеводном составе молочно-растительных экстрактов присутствует инулин до 4,2%, обеспечивая их антидиабетические свойства. Богатый витаминный комплекс фитоэкстрактов позволяет обеспечить организм человека витамином С на 65-68%, В1 – 28 -29%, В2 – 31 - 33,3%, В9 – 63,5 - 69%, РР – 18-21%.

В результате поискового эксперимента по оптимизации рецептуры концентратов киселей подобрана норма молочно-растительных экстрактов – не более 30% массы сырья.

В ходе исследований обоснована модифицированная технологическая схема производства киселей, обогащенных биологически активными веществами в составе экстрактов лекарственных растений.



УДК [614.31:63]:575
ИЗУЧЕНИЕ ГЕНЕТИЧЕСКИ МОДИФИЦИРОВАННЫХ ИНГРЕДИЕНТОВ В НЕКОТОРЫХ ПРОДУКТАХ ПИТАНИЯ

Ли М., студент ФЕН, гр. Бт-22р

Евразийский Национальный Университет им. Л.Н. Гумилева, г. Астана

Научный руководитель: к.б.н., доцент Погосян Г.П.
Во всем мире рынок продуктов питания наводнен товарами, содержащими генетически модифицированные организмы. В сельских хозяйствах многих ведущих стран-экспортеров растительных продуктов питания и растительного сырья уже давно выращиваются растения с измененным генетическим кодом. Получение все новых трансгенных растений считается на данный момент одним из перспективных и наиболее развивающихся направлений биотехнологии в сфере агропроизводства. Проблема наличия в пищевых продуктах генетически модифицированных ингредиентов (ГМИ) является актуальной в Республике Казахстан, как и во всём мире. Отсутствие информации о качестве употребляемой пищи делает невозможным прогноз здоровья населения в ближайшем будущем. Поэтому возникает необходимость изучения пищевых продуктов на предмет присутствия в них ГМО.

Целью данного исследования было тестирование колбасных продуктов, шоколадных изделий и соков с мякотью на наличие в них ГМИ.



Важными критериями отбора являлись доступность цен; распространенность на рынке продуктов питания; отсутствие маркировки на содержание ГМИ.

Каталог: repository -> repository2012
repository2012 -> Шындалиева Меңдігүл Бұрханқызы бақ-тағы жарнама технологиясы
repository2012 -> Әож 811. 512. 122 3: 82. 091 Қолжазба құқығында тапанова сәуле есембекқызы қазақ романдарындағы ғашықтық сарын
repository2012 -> Махсат Алпысбес
repository2012 -> Білім саласындағы жаңа ақпараттық технологиялар
repository2012 -> Қаржаубай Сартқожаұлы, тарих ғылымының кандидаты, доцент, түрколог байырғы түркі «Ж» фонемі қАҚында
repository2012 -> Қазақстан республикасының білім және ғылым министірлігі
repository2012 -> Қ. Т. Қозыбаев, М. Н. Иманқұл Wimax технологиясы
repository2012 -> Қазақстан республикасы білім және ғылым министрлігі ministry of education and science of republic of kazakhstan


Достарыңызбен бөлісу:
1   2   3   4   5   6   7   8


©netref.ru 2019
әкімшілігінің қараңыз

    Басты бет